Review



pgex 6p 1 stu2  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 91

    Structured Review

    Addgene inc pgex 6p 1 stu2
    Pgex 6p 1 Stu2, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pgex 6p 1 stu2/product/Addgene inc
    Average 91 stars, based on 4 article reviews
    pgex 6p 1 stu2 - by Bioz Stars, 2026-04
    91/100 stars

    Images



    Similar Products

    91
    Addgene inc pgex 6p 1 stu2
    Pgex 6p 1 Stu2, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pgex 6p 1 stu2/product/Addgene inc
    Average 91 stars, based on 1 article reviews
    pgex 6p 1 stu2 - by Bioz Stars, 2026-04
    91/100 stars
      Buy from Supplier

    94
    Addgene inc pgex 6p hdcp2 plasmid
    Pgex 6p Hdcp2 Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pgex 6p hdcp2 plasmid/product/Addgene inc
    Average 94 stars, based on 1 article reviews
    pgex 6p hdcp2 plasmid - by Bioz Stars, 2026-04
    94/100 stars
      Buy from Supplier

    93
    Addgene inc pgex 6p 1 gst plasmid
    Pgex 6p 1 Gst Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pgex 6p 1 gst plasmid/product/Addgene inc
    Average 93 stars, based on 1 article reviews
    pgex 6p 1 gst plasmid - by Bioz Stars, 2026-04
    93/100 stars
      Buy from Supplier

    93
    Addgene inc ttgaacctgatctccatcca n a n a recombinant dna pca24n nbrp rrid ncbitaxon 146876 pcp20 cgsc cgsc
    Ttgaacctgatctccatcca N A N A Recombinant Dna Pca24n Nbrp Rrid Ncbitaxon 146876 Pcp20 Cgsc Cgsc, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/ttgaacctgatctccatcca n a n a recombinant dna pca24n nbrp rrid ncbitaxon 146876 pcp20 cgsc cgsc/product/Addgene inc
    Average 93 stars, based on 1 article reviews
    ttgaacctgatctccatcca n a n a recombinant dna pca24n nbrp rrid ncbitaxon 146876 pcp20 cgsc cgsc - by Bioz Stars, 2026-04
    93/100 stars
      Buy from Supplier

    93
    Addgene inc pgex 6p 1
    Pgex 6p 1, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pgex 6p 1/product/Addgene inc
    Average 93 stars, based on 1 article reviews
    pgex 6p 1 - by Bioz Stars, 2026-04
    93/100 stars
      Buy from Supplier

    90
    Addgene inc pgex 6p 1 gst prmt2
    Pgex 6p 1 Gst Prmt2, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pgex 6p 1 gst prmt2/product/Addgene inc
    Average 90 stars, based on 1 article reviews
    pgex 6p 1 gst prmt2 - by Bioz Stars, 2026-04
    90/100 stars
      Buy from Supplier

    91
    Addgene inc pgex 6p 1 gst rh mnase
    Pgex 6p 1 Gst Rh Mnase, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pgex 6p 1 gst rh mnase/product/Addgene inc
    Average 91 stars, based on 1 article reviews
    pgex 6p 1 gst rh mnase - by Bioz Stars, 2026-04
    91/100 stars
      Buy from Supplier

    90
    GenScript corporation pgex-6p-2
    Pgex 6p 2, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pgex-6p-2/product/GenScript corporation
    Average 90 stars, based on 1 article reviews
    pgex-6p-2 - by Bioz Stars, 2026-04
    90/100 stars
      Buy from Supplier

    90
    Addgene inc pgex sesn2
    Pgex Sesn2, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pgex sesn2/product/Addgene inc
    Average 90 stars, based on 1 article reviews
    pgex sesn2 - by Bioz Stars, 2026-04
    90/100 stars
      Buy from Supplier

    Image Search Results