Review



pgex 6p 1 stu2  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 91
      Buy from Supplier

    Structured Review

    Addgene inc pgex 6p 1 stu2
    Pgex 6p 1 Stu2, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pgex 6p 1 stu2/product/Addgene inc
    Average 91 stars, based on 4 article reviews
    pgex 6p 1 stu2 - by Bioz Stars, 2026-04
    91/100 stars

    Images



    Similar Products

    pgex 6p 1 stu2  (Addgene inc)
    91
    Addgene inc pgex 6p 1 stu2
    Pgex 6p 1 Stu2, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pgex 6p 1 stu2/product/Addgene inc
    Average 91 stars, based on 1 article reviews
    pgex 6p 1 stu2 - by Bioz Stars, 2026-04
    91/100 stars
    		  Buy from Supplier
    pgex 6p hdcp2 plasmid  (Addgene inc)
    94
    Addgene inc pgex 6p hdcp2 plasmid
    Pgex 6p Hdcp2 Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pgex 6p hdcp2 plasmid/product/Addgene inc
    Average 94 stars, based on 1 article reviews
    pgex 6p hdcp2 plasmid - by Bioz Stars, 2026-04
    94/100 stars
    		  Buy from Supplier
    pgex 6p 1 gst plasmid  (Addgene inc)
    93
    Addgene inc pgex 6p 1 gst plasmid
    Pgex 6p 1 Gst Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pgex 6p 1 gst plasmid/product/Addgene inc
    Average 93 stars, based on 1 article reviews
    pgex 6p 1 gst plasmid - by Bioz Stars, 2026-04
    93/100 stars
    		  Buy from Supplier
    ttgaacctgatctccatcca n a n a recombinant dna pca24n nbrp rrid ncbitaxon 146876 pcp20 cgsc cgsc  (Addgene inc)
    93
    Addgene inc ttgaacctgatctccatcca n a n a recombinant dna pca24n nbrp rrid ncbitaxon 146876 pcp20 cgsc cgsc
    Ttgaacctgatctccatcca N A N A Recombinant Dna Pca24n Nbrp Rrid Ncbitaxon 146876 Pcp20 Cgsc Cgsc, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/ttgaacctgatctccatcca n a n a recombinant dna pca24n nbrp rrid ncbitaxon 146876 pcp20 cgsc cgsc/product/Addgene inc
    Average 93 stars, based on 1 article reviews
    ttgaacctgatctccatcca n a n a recombinant dna pca24n nbrp rrid ncbitaxon 146876 pcp20 cgsc cgsc - by Bioz Stars, 2026-04
    93/100 stars
    		  Buy from Supplier
    pgex 6p 1  (Addgene inc)
    93
    Addgene inc pgex 6p 1
    Pgex 6p 1, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pgex 6p 1/product/Addgene inc
    Average 93 stars, based on 1 article reviews
    pgex 6p 1 - by Bioz Stars, 2026-04
    93/100 stars
    		  Buy from Supplier
    pgex 6p 1 gst prmt2  (Addgene inc)
    90
    Addgene inc pgex 6p 1 gst prmt2
    Pgex 6p 1 Gst Prmt2, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pgex 6p 1 gst prmt2/product/Addgene inc
    Average 90 stars, based on 1 article reviews
    pgex 6p 1 gst prmt2 - by Bioz Stars, 2026-04
    90/100 stars
    		  Buy from Supplier
    pgex 6p 1 gst rh mnase  (Addgene inc)
    91
    Addgene inc pgex 6p 1 gst rh mnase
    Pgex 6p 1 Gst Rh Mnase, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pgex 6p 1 gst rh mnase/product/Addgene inc
    Average 91 stars, based on 1 article reviews
    pgex 6p 1 gst rh mnase - by Bioz Stars, 2026-04
    91/100 stars
    		  Buy from Supplier
    pgex-6p-2  (GenScript corporation)
    90
    GenScript corporation pgex-6p-2
    Pgex 6p 2, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pgex-6p-2/product/GenScript corporation
    Average 90 stars, based on 1 article reviews
    pgex-6p-2 - by Bioz Stars, 2026-04
    90/100 stars
    		  Buy from Supplier
    pgex sesn2  (Addgene inc)
    90
    Addgene inc pgex sesn2
    Pgex Sesn2, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pgex sesn2/product/Addgene inc
    Average 90 stars, based on 1 article reviews
    pgex sesn2 - by Bioz Stars, 2026-04
    90/100 stars
    		  Buy from Supplier

    Image Search Results